View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_19 (Length: 353)
Name: NF4512_low_19
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 20 - 306
Target Start/End: Complemental strand, 5053894 - 5053608
Alignment:
| Q |
20 |
ttgaagtctccgcaacagtattgccacggtaatataagggattttgaagcctccgcaacagtattgccactgtaatataagggattttaaagtctccaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053894 |
ttgaagtctccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgccactgtaatataagggattttaaagtctccaca |
5053795 |
T |
 |
| Q |
120 |
acagtattgcaaccgcaattttgacatcttattcctgcatttttctgcaatataaaggtttgcaacataactagaaccactatatataatctatagttgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5053794 |
acagtattgcaaccgcaattttgacatcttattcccgcatttttctgcaatataaaggtttgcaacgtaactagaaccactatatataatctatagttgg |
5053695 |
T |
 |
| Q |
220 |
tagtattagttttgtcaccgtcaagggacaatagtagttgtatagttttcagaaattgattcaaattctgtgatgcaaacaagtgaa |
306 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5053694 |
tagtattagttttgccaccgtcgagggacaatagtagttgtatagttttcagaaattgattcaaattctgtgatgctaacaagtgaa |
5053608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 5053899 - 5053828
Alignment:
| Q |
58 |
ggattttgaagcctccgcaacagtattgccactgtaatataagggattttaaagtctccacaacagtattgc |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5053899 |
ggattttgaagtctccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgc |
5053828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University