View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4512_low_28 (Length: 318)

Name: NF4512_low_28
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4512_low_28
NF4512_low_28
[»] chr2 (2 HSPs)
chr2 (1-137)||(4275085-4275220)
chr2 (204-273)||(4275287-4275356)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 4275085 - 4275220
Alignment:
1 aaatatgagatcaatcgttttgattagtcgatctttaaatcagatatagagtggaaggagnnnnnnnnggcctagtgaaatggatattttgggatatcat 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| ||  ||||| ||        |||| |||||||||||||||||||||||||||    
4275085 aaatatgagatcaatcgttttgattggtcgatctttaaatcagatatcgaacggaagaagaaaaaaa-ggcccagtgaaatggatattttgggatatcat 4275183  T
101 caaactaaactttctttgtaattaatataaaaattgg 137  Q
     |||||||||||||||||||||| |||||||||||||    
4275184 taaactaaactttctttgtaatttatataaaaattgg 4275220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 204 - 273
Target Start/End: Original strand, 4275287 - 4275356
Alignment:
204 gcaggaacagatgaagcagtggtgcagttgctgtaacaatgctgagactgttgggtgtgatgtgtgtggc 273  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4275287 gcaggaacagatgaagcagtggtgcagttgctgtaacaatgctgagactgttgggtgtgatgtgtgtggc 4275356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University