View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_28 (Length: 318)
Name: NF4512_low_28
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 4275085 - 4275220
Alignment:
| Q |
1 |
aaatatgagatcaatcgttttgattagtcgatctttaaatcagatatagagtggaaggagnnnnnnnnggcctagtgaaatggatattttgggatatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| || ||||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
4275085 |
aaatatgagatcaatcgttttgattggtcgatctttaaatcagatatcgaacggaagaagaaaaaaa-ggcccagtgaaatggatattttgggatatcat |
4275183 |
T |
 |
| Q |
101 |
caaactaaactttctttgtaattaatataaaaattgg |
137 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4275184 |
taaactaaactttctttgtaatttatataaaaattgg |
4275220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 204 - 273
Target Start/End: Original strand, 4275287 - 4275356
Alignment:
| Q |
204 |
gcaggaacagatgaagcagtggtgcagttgctgtaacaatgctgagactgttgggtgtgatgtgtgtggc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4275287 |
gcaggaacagatgaagcagtggtgcagttgctgtaacaatgctgagactgttgggtgtgatgtgtgtggc |
4275356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University