View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_33 (Length: 296)
Name: NF4512_low_33
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 38582487 - 38582297
Alignment:
| Q |
18 |
aaatatatctttacattgaagctcatagatagaattgcagggtaattaagcactgtggattggtgcnnnnnnnncctaccaaaaattgtcctctaaggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38582487 |
aaatatatctttacattgaagctcatagatagaattgcagggtaattaagcactctggattggtgcttttgtttcctaccaaaaattgtcctctaaggaa |
38582388 |
T |
 |
| Q |
118 |
agnnnnnnnnn-taaaactaggagactttaattatggattggtggattctttgaggcaggtgtgtaatccattgtatccaacaagtcatca |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582387 |
agaaaaaataaataaaactaggagactttaattatggattggtggattctttgaggcaggtgtgtaatccattgtatccaacaagtcatca |
38582297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 246 - 285
Target Start/End: Complemental strand, 38582258 - 38582219
Alignment:
| Q |
246 |
cccttcatggtttagcttaaacaagctactttgacccttt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582258 |
cccttcatggtttagcttaaacaagctactttgacccttt |
38582219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University