View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_35 (Length: 286)
Name: NF4512_low_35
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 34678348 - 34678559
Alignment:
| Q |
1 |
aatttctttcacaaatgagcatttactaaattccttgaagtattttataagcataaatagaagtctaatttataaacttctagatgaatctaattaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34678348 |
aatttctttcacaaatgagcatttactaaattccttgaagtattttataagcataaatagaagtctaatttataaacttctagatgaatcttattaattt |
34678447 |
T |
 |
| Q |
101 |
cattacaaaccttatttctatttgcacccatcctatatgcagtattgtcatcgatatgaggttggaagtattttttatgtgaagaagtgcacattagttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34678448 |
cattacaaaccttatttctatttgcacccatcctatatgcaatattgtcatcgatatgaggttggaagtatttcttatgtgaagaagtgcacattagttg |
34678547 |
T |
 |
| Q |
201 |
ttaacctgcatt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34678548 |
ttaacctgcatt |
34678559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 241 - 276
Target Start/End: Original strand, 34678588 - 34678623
Alignment:
| Q |
241 |
ttattgtcatgaattacttcctccgccatgcctatg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34678588 |
ttattgtcatgaattacttcctccgccatgcctatg |
34678623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University