View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_39 (Length: 253)
Name: NF4512_low_39
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 33119702 - 33119483
Alignment:
| Q |
19 |
aaaattggggtccttttaacttccttttccatttcaaaaggaaagaaaagcactacaagagtaccttcaaatgctacaacctgtgaattttctcaatttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33119702 |
aaaattggggtccttttaacttccttttccatttgaaaaggaaagaaaagcactacaagagtaccttcaaatgctacaacctgtgaattttctcaatttc |
33119603 |
T |
 |
| Q |
119 |
attctcactggtcctattacaattgccacacaaacttaactccaagtttcaatctcacttttatttctctttcagtacaataattaacacacactactca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33119602 |
attctcactggtcctattacaattgccacacaaacttaactccaagtttcaatctcacttttatttctctttcagtacaataattaacacacactactca |
33119503 |
T |
 |
| Q |
219 |
gtgtttggctcacatctctg |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33119502 |
gtgtttggctcacatctctg |
33119483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University