View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4512_low_43 (Length: 245)

Name: NF4512_low_43
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4512_low_43
NF4512_low_43
[»] chr7 (1 HSPs)
chr7 (1-232)||(36424314-36424545)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 36424545 - 36424314
Alignment:
1 ccaaatgaatatggtttacaatgggatcaggaggttcagatagtaaatatctactaggctccgtaatggcattcctagcgaggtaatgggcgaccgaata 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
36424545 ccaaatgaatttggtttacaatgggatcaggaggttcagatagtaaatatctactaggctccgaaatggcattcctagcaaggtaatgggcgaccgaata 36424446  T
101 acctcttcttcctacaagaagaaatttgcttttcacacatctatgatttgctctctggcatcctaaactgacgaaaattctccggcgggggttaacttat 200  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||| ||| ||||| |||||||||||    
36424445 acctcttcatcctacaagaagaaatttgcctttcacacatctatgattttctctttggcatcctaaactgacgaaaatactctggcggcggttaacttat 36424346  T
201 gtttggagaacctttaagtcggttaagtgtct 232  Q
    ||||||||||||||||||||||||||||||||    
36424345 gtttggagaacctttaagtcggttaagtgtct 36424314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University