View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_44 (Length: 243)
Name: NF4512_low_44
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_44 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 45954511 - 45954735
Alignment:
| Q |
19 |
aacatcaaatccttctgctgagagactagattttacaaaatcatagtctttcctgtctcctttcaaatgcaagatctatgaaataaaaataaattacatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45954511 |
aacatcaaatccttctgctgagagactagattttacaaaatcatagtctttcctgtctcctttcaaatgcaagatctatgaaataaaaataagttacatt |
45954610 |
T |
 |
| Q |
119 |
acattacaaaaatagtgaatgatccagctttgatgtttacatttacaattagcataccttggaagaaaaatcagcaaagtcagtgtctgattcacctggc |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45954611 |
acattacaaaaatagtgaatgaaacagctttgatgtttacatttacaattaacataccttggaagaaaaatcagcaaagtcagtgtctgattcacctggc |
45954710 |
T |
 |
| Q |
219 |
aattgttgagtgataggtgcttttc |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45954711 |
aattgttgagtgataggtgcttttc |
45954735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University