View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4512_low_51 (Length: 236)

Name: NF4512_low_51
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4512_low_51
NF4512_low_51
[»] chr1 (1 HSPs)
chr1 (9-236)||(39417838-39418065)
[»] chr7 (1 HSPs)
chr7 (9-233)||(44513419-44513643)


Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 236
Target Start/End: Complemental strand, 39418065 - 39417838
Alignment:
9 atcatcacttccttcaatggctgtacacccaggaaagatccagtgttcagcaggtttcagtgtgatgagttcacaatctcctaatcccaacattctagtg 108  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39418065 atcatctcttccttcaatggctgtacacccaggaaagatccagtgttcagcaggtttcagtgtgatgagttcacaatctcctaatcccaacattctagtg 39417966  T
109 ggtgctgttgtcggaggaccagatcagcatgataggtttccagataaacggtcagattatgagcaatcagagccagcaacttatgttaatgcaccacttg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39417965 ggtgctgttgtcggaggaccagatcagcatgataggtttccagataaacggtcagattatgagcaatcagagccagcaacttatgttaatgcaccacttg 39417866  T
209 tagggacacttgcttatcttgcacactc 236  Q
    ||||||||||||||||||||||||||||    
39417865 tagggacacttgcttatcttgcacactc 39417838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 44513419 - 44513643
Alignment:
9 atcatcacttccttcaatggctgtacacccaggaaagatccagtgttcagcaggtttcagtgtgatgagttcacaatctcctaatcccaacattctagtg 108  Q
    |||||||||||| || || ||||| ||||| || |||||||| ||||||| ||| |||||||| |||   |||||||| ||||| |||||||||||||||    
44513419 atcatcacttccatctattgctgttcaccctggcaagatccaatgttcagaaggattcagtgtaatggactcacaatcccctaaccccaacattctagtg 44513518  T
109 ggtgctgttgtcggaggaccagatcagcatgataggtttccagataaacggtcagattatgagcaatcagagccagcaacttatgttaatgcaccacttg 208  Q
    ||| | ||||| || ||||| |||  ||||||||| ||||||||| |||| |||||||||||||||||||||||||| |||||  | |||||||| ||||    
44513519 ggtacagttgttgggggacctgatttgcatgatagctttccagatgaacgttcagattatgagcaatcagagccagctacttacatcaatgcacctcttg 44513618  T
209 tagggacacttgcttatcttgcaca 233  Q
    ||||  || | ||||||||||||||    
44513619 taggagcattggcttatcttgcaca 44513643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University