View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_52 (Length: 235)
Name: NF4512_low_52
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_52 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 56251 - 56034
Alignment:
| Q |
18 |
ggcaatggggttcataagcttcataagtggaaccctatattataggaacaagcctccacaaccaaccatctttctccccattgctcaagtatgatcaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56251 |
ggcaatggggttcataagcttcataagtggaaccctatattataggaacaagcctccacaaccaaccatctttctccccattgctcaagtatgatcaaca |
56152 |
T |
 |
| Q |
118 |
tttcatatctaatttatcttttcaaatatagtatatatcaatcaattgccttctgtaaatattaataatacgtatgatcaggtttttgtagctgcaatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56151 |
tttcatatctaatttatcttttcaaatatagtatatatcaatcaattgccttctgtaaatattaataatacgtatgatcaggtttttgtagctgcaatat |
56052 |
T |
 |
| Q |
218 |
taaaaaggaagaagattt |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
56051 |
taaaaaggaagaagattt |
56034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University