View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4512_low_53 (Length: 223)
Name: NF4512_low_53
Description: NF4512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4512_low_53 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 9111079 - 9111291
Alignment:
| Q |
11 |
caaagggacgatggtagacaacaaccactattcaaataataacattcacaaactatttattaacaacatacctccaacaattttcaagtttggcatttcg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9111079 |
caaagggacgatggtagacaacaaccactattcaaataataacattcacaaactatttcttaacaacatacctccaacaatttttaagtttggcatttcg |
9111178 |
T |
 |
| Q |
111 |
aagattgaaatagcaggttgcagttgatgaaatcgcagcagttgacgaggaaattgcagcaccgcaaacaggaaggacgaaatctcaatagatgaaaggt |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9111179 |
aagattgaaatagcaggttgcaattgatgaaatcgcagcagttgacgaggaaattgcagcaccgcaaacaggaaggacggaatctcaatagatgaaaggt |
9111278 |
T |
 |
| Q |
211 |
tgaagatgtagtc |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9111279 |
tgaagatgtagtc |
9111291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University