View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513-Insertion-5 (Length: 487)
Name: NF4513-Insertion-5
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 8 - 447
Target Start/End: Original strand, 52026317 - 52026758
Alignment:
| Q |
8 |
ttttttaggtgagaaaacttcctcccgttcaatttcatatccaattgacgaaggtgacaaagtatttggg-ttgtctgatatttgctagaggttaatcga |
106 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
52026317 |
tttttttggcgagaaaacttcctcccgttcaatttcatatccaattgaccaagctgacaaagtatttggggttgtctgatatttgctagaggttaaccga |
52026416 |
T |
|
| Q |
107 |
gtgcctatccctcacaaatgataaagaatctctacaactattacatcgaaatgaccgtttgtaaaatgttatttatgaggggtaaaaccctagcaa--ac |
204 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| || |
|
|
| T |
52026417 |
gtgcctacccctcacaaatgataaagaatgtctacaactattacatcgaaatgaccgtttgtaaaatgttatttatgtggggtaaaaccctcgcaaacac |
52026516 |
T |
|
| Q |
205 |
acacaaactcctcacctttttcgaccagttcattacaaatatgcttgtttttcaatgtgaattgaacattatg-catgttggtatgcaaggggcaacccc |
303 |
Q |
| |
|
||||| ||||||||||| |||||| || ||||||||||||||||||| |||||| ||||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
52026517 |
acacacactcctcacctgtttcgatcaattcattacaaatatgcttgcttttcactgtgaattgaacattctgacatgttggtatgcgaggggcaacccc |
52026616 |
T |
|
| Q |
304 |
ttgcaaaacccccggggagaaatcaccttaaattatgttcaatgctcttcgtcctcattcatccatcataaatttttaaaatgacatagttctttcttgt |
403 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52026617 |
ttgcaaaaccctcggggcaaaatcagcttaaattatgttcaacgctcttcgtcctcattcatccatcataaatttttaaaatgacatagttctttcttgt |
52026716 |
T |
|
| Q |
404 |
catatgttttctttcttcctccaatttctttcatagtacttttt |
447 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52026717 |
c--atgttttctttcttcctccaatttccttcatagtacttttt |
52026758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University