View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513-Insertion-6 (Length: 291)
Name: NF4513-Insertion-6
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 9 - 133
Target Start/End: Complemental strand, 47294404 - 47294280
Alignment:
| Q |
9 |
taattttgttgaaattcgaaaatgaagcttttaccaaaatcatggtggtttccgatcatcacgtcaaatttacttatttttaaacattcacaaaatgtaa |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||| ||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
47294404 |
taattttgttgaaattcgaaaatgtagcttttaccaaaatcatggtggtttcccattgtcacatcaaatttactcattttcaaacatgcacaaaatgtaa |
47294305 |
T |
|
| Q |
109 |
gcaagtagcaaagggatattcaagt |
133 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47294304 |
gcaagtagcaaagggatattcaagt |
47294280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University