View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513-Insertion-7 (Length: 285)
Name: NF4513-Insertion-7
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513-Insertion-7 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 129 - 285
Target Start/End: Original strand, 46840098 - 46840266
Alignment:
| Q |
129 |
gagttattcaaggtaataaaaacacatcaggactgtggccgcatggttattttatggttaca------------atgaggctgtcaacatatccatttac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46840098 |
gagttattcaaggtaataaaaacacatcaggactgtggccgcatggttattttatggttacactgtaggcggcaatgaggctgtcaacatatccatttac |
46840197 |
T |
|
| Q |
217 |
attttgtagttgataaacttttgctggggaaaaggttggacaaatgaatagcaatgaaaactgtgctta |
285 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46840198 |
attttgtagttgataaacttttgttggggaaaaagttggacaaatgaatagcaatgaaaactgtgctta |
46840266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 46839977 - 46840038
Alignment:
| Q |
8 |
atagttgaagtgttgtaaatctcatacttctccttttatggcgggctgacatgatatccgtc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46839977 |
atagttgaagtgttgtaaatctcatacttctccttttatggcgggctaacatgatatccgtc |
46840038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University