View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513-Insertion-8 (Length: 243)
Name: NF4513-Insertion-8
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 219
Target Start/End: Complemental strand, 53308695 - 53308484
Alignment:
| Q |
8 |
cctggggcactatatttgatgatacatatatatatttgattgatgttgagaaatgaaaatgtacatgtagtaagcacaaatgtcgggagtggtcagatag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53308695 |
cctggggcactatatttgatgatacatatatatatttgattgatgttgagaaatgaaaatgtacatgtagtaagcacaaatgtcgggagtggtcagatag |
53308596 |
T |
|
| Q |
108 |
atgtctagaatccaccccactctcgtggcttagttttactttttcaagatcatatttaatagtatacacaaatcctataactattactactaatttttcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53308595 |
atgtctagaatccaccccactctcgtggcttagttttactttttcaagatcatatttaatagtatactcaaatcctataactattactactaatttttcc |
53308496 |
T |
|
| Q |
208 |
cttataaaatat |
219 |
Q |
| |
|
|||||||||||| |
|
|
| T |
53308495 |
cttataaaatat |
53308484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University