View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_24 (Length: 403)
Name: NF4513_high_24
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 9796895 - 9796653
Alignment:
| Q |
1 |
gttttcatcaatatctcctaacccaaacaactacctacacatttttcaatatttgtcacatgcaaaaaacatcttctgatatataactacattaaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796895 |
gttttcatcaatatctcctaacccaaacaactacctacacatttttcaatatttgtcacatgcaaaaaacatcttctgatatataactacattaaataaa |
9796796 |
T |
|
| Q |
101 |
tatatgacatgatgtcactcacgttcttggatcacgtgcaaaccatgttttgcatagctgtttcttgctgtagggtcttctagtgggatttctttgaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796795 |
tatatgacatgatgtcactcacgttcttggatcacgtgcaaaccatgttttgcatagctgtttcttgctgtagggtcttctagtgggatttctttgaaaa |
9796696 |
T |
|
| Q |
201 |
tggcttctttgtctcctgtggttgttgaaatacttatttgaac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796695 |
tggcttctttgtctcctgtggttgttgaaatacttatttgaac |
9796653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 305 - 388
Target Start/End: Complemental strand, 9796591 - 9796508
Alignment:
| Q |
305 |
aggggtgattagattggatttgatgaattatgtaatgggacaagaatggcaccagggaattgttgcagctctgaggtagcagct |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796591 |
aggggtgattagattggatttgatgaattatgtaatgggacaagaatggcaccagggaattgttgcagctctgaggtagcagct |
9796508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University