View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_33 (Length: 314)
Name: NF4513_high_33
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 25703318 - 25703040
Alignment:
| Q |
18 |
cataggggtgtggaaagaacttaaagattataccggttttaaatcaagtagtggtttggtcaaaaccattgttatatccgaaggaaacatcttcaccggt |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703318 |
cataagggtgtggaaagaacttaaagattataccggttttaaatcaagtagtggtttggtcaaatccattgttatatccgaaggaaacatcttcaccggt |
25703219 |
T |
 |
| Q |
118 |
catcaagatggaaaaatcagagtttggaaaatttcttcaaaaaattctagaaatcataagcgtattggaagcttaccaactttcaaagactatgtcaaaa |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703218 |
catcaagatggaaaaatcagggtttggaaaatttcttcaaaaaattctagaaatcataagcgtattggaagcttaccaactttcaaagactatgtcaaaa |
25703119 |
T |
 |
| Q |
218 |
gctcgatgaatccaaagaactacgtagaagtccggcgacggagaaacacagtgaaggtgaagcatttcgacgctgtttc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25703118 |
gctcgatgaatccaaagaactacgtagaagtccggcgacggagaaacaccgtgaaggtgaagcatttcgacgctgtttc |
25703040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University