View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_44 (Length: 257)
Name: NF4513_high_44
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 13 - 239
Target Start/End: Complemental strand, 54498451 - 54498220
Alignment:
| Q |
13 |
catcagattggggatctacattcagttcattcgcaactaatgtgattgtgagtgacattactttcaaggtaaaatcaagaaaaatcaatacaannnnnnn |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498451 |
catcagattggggatctacattcagttcattcgcaactaatgtgattgtgagtgacattactttcaaggtaaaatcaagaaaaatcaatacaattttttt |
54498352 |
T |
 |
| Q |
113 |
nn-gatatctctcccatatttgtatttagttaatataaca----gattattgtatgattgcagaactcatataatttggaagggggttcagatgatatcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54498351 |
tttgatatctctcccatatttgtatttagttaatataacacattaattattgtatgattgcagaactcatataatttggaaggaggttcagatgatatcg |
54498252 |
T |
 |
| Q |
208 |
aacaggcattgtcagctgctttctacggagac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54498251 |
aacaggcattgtcagctgctttctacggagac |
54498220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University