View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_53 (Length: 249)
Name: NF4513_high_53
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 15363235 - 15363029
Alignment:
| Q |
13 |
gggttcctttttatctttttaggaatgtcataattagggtaaggtaagattatagtttgtacaatgtgttgaaatattggtgagcgctatgaatcactga |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15363235 |
gggttcctttttatttttttaggaatgtcataattagggtaaggtaagattatagtttgtacaatgtgttgaaatattggtgagcgctatgaatcactga |
15363136 |
T |
|
| Q |
113 |
cactaactcacacgtagacgctgttaatctctgcagtgaagacacctctcgcttaaagcgtgtcccagtatccgacacctgtacgacatgtgtcagacta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
15363135 |
cactaactcacacgtagacgctgttaatctctgcagtgaagacacctctcgcttaaagcgtgtcccagtatccgacacctgcacaacatgtgtcagacta |
15363036 |
T |
|
| Q |
213 |
gtgtccc |
219 |
Q |
| |
|
||||||| |
|
|
| T |
15363035 |
gtgtccc |
15363029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Complemental strand, 7705174 - 7705138
Alignment:
| Q |
183 |
tccgacacctgtacgacatgtgtcagactagtgtccc |
219 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7705174 |
tccgacacccgtacgacatgtgtcagacaagtgtccc |
7705138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University