View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_57 (Length: 247)
Name: NF4513_high_57
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 38478028 - 38477791
Alignment:
| Q |
1 |
tgtttggaaatgtatccgtgggaggtggacttgtagcttggcttgtaaggtacatag-tgtgagcatttactgaagttgggtctcatttgagagtgcatt |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38478028 |
tgtttggaaatatatccgtgggaggtggacttgtagcttggcttgtaaggtacataggtgtgagcatttactgaagttgggtctcatttgagagtgcatt |
38477929 |
T |
 |
| Q |
100 |
gacggtggttgcagaggttagacctgctcaggtaacggttgagaccattgctgttgctacagctgttatggctgctgatactgagaaaattgttgtgcag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38477928 |
gacggtggttgcagaggttagacctgctcaggtaacggttgagaccattgctgttgctgcagctgttatggctgctgatactgagaaaattgttgtgcag |
38477829 |
T |
 |
| Q |
200 |
tcggtggctggtttacttgagatgatgttgatgatgat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38477828 |
tcggtggctggtttacttgagatgatgttgatgatgat |
38477791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 38467355 - 38467138
Alignment:
| Q |
8 |
aaatgtatccgtgggaggtggacttgtagcttggcttgtaaggtacatagtgtgagcatttactgaagttgggtctcatttgagagtgcattgacggtgg |
107 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||||||||||||||||| || | |||||||||||| | ||||||||||||||| |||||| | ||||| |
|
|
| T |
38467355 |
aaatgtgtccgtaggaggtagacttgtagcttggcttgtaaggtacggagcataagcatttactgatgg-gggtctcatttgagaatgcattaagggtgg |
38467257 |
T |
 |
| Q |
108 |
ttgcagaggttagacctgctcaggtaacggttgagaccattgctgttgctacagctgttatggctgctgatactgagaaaattgttgtgcagtcggtggc |
207 |
Q |
| |
|
||||| ||||| ||||||| ||| |||||||||||||||||||| | ||||| |||||||||||||||||||||||||| |||| | | | |
|
|
| T |
38467256 |
ttgcataggttgcacctgctgaggcaacggttgagaccattgctg------cttctgttgcggctgctgatactgagaaaattgttgcacagttgaggac |
38467163 |
T |
 |
| Q |
208 |
tggtttacttgagatgatgttgatg |
232 |
Q |
| |
|
||| ||||||||||| ||||||||| |
|
|
| T |
38467162 |
tggattacttgagataatgttgatg |
38467138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 157
Target Start/End: Complemental strand, 38473189 - 38473039
Alignment:
| Q |
6 |
ggaaatgtatccgtgggaggtggacttgtagcttggcttgtaaggtacatagtgtgagcatttactgaagttgggtctcatttgagagtgcattgacggt |
105 |
Q |
| |
|
|||||||| || ||| |||||||||||||||||||||||||||| ||| ||||| |||||||||||| | ||||||||||| ||| |||||||| ||| |
|
|
| T |
38473189 |
ggaaatgtgtcggtgagaggtggacttgtagcttggcttgtaagatacggagtgtaagcatttactgatg-ggggtctcattttagaatgcattgagggt |
38473091 |
T |
 |
| Q |
106 |
ggttgcagaggttagacctgctcaggtaacggttgagaccattgctgttgct |
157 |
Q |
| |
|
||||||| ||||| || ||| |||| || |||||| |||||| ||||||| |
|
|
| T |
38473090 |
ggttgcaaaggttgcactagctgaggtgactgttgaggccattgttgttgct |
38473039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University