View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_63 (Length: 240)
Name: NF4513_high_63
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_63 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 31294756 - 31294977
Alignment:
| Q |
19 |
ttgatatggttgacaatgatataagtaaattccagatttcaattgctttatgatgataggactttttagtcaaagtagcttagaggttaagaaaaaatat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31294756 |
ttgatatggttgacaatgatataagtaaattccagatttcaattgctttatgatgataggacttattagtgaaagtagcttagaggttaagaaaaaatat |
31294855 |
T |
|
| Q |
119 |
taagaaagatatagagattaatggaatttgttcagatttgtttggatgaagtttgtgtcatattttgttaattgctatgtcaaattttcatcgtttgcct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31294856 |
taagaaagatatagagattaatggaatttgttcagatttgtttggatgaagtttgtgtcatattttgttaattgctatgtcaaattttcatcgtttgcct |
31294955 |
T |
|
| Q |
219 |
aaaccctattttagaaattttt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31294956 |
aaaccctattttagaaattttt |
31294977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 88
Target Start/End: Original strand, 12443075 - 12443131
Alignment:
| Q |
32 |
caatgatataagtaaattccagatttcaattgctttatgatgataggactttttagt |
88 |
Q |
| |
|
|||| |||| ||||| ||||||||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
12443075 |
caattatattagtaatttccagatttcaattgcttcatgatgatatggctttttagt |
12443131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University