View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_67 (Length: 238)
Name: NF4513_high_67
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 2616954 - 2616758
Alignment:
| Q |
18 |
ataatgtagcttaattatctatatagtacatcatagagtcgagatattcaacagacacaaacacannnnnnnnnnnngcatgaaccactgagtaactttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2616954 |
ataatgtagcttaattatctatatagtacatcatagagtcgagatattcaacagacacaaacacattttttatttttgcatgaaccactgagtaactttt |
2616855 |
T |
|
| Q |
118 |
ctcctttcctgcaaagataatcacattgttggttggcaggtttatcaacgcataccccagagaacaaagcactcggtttttcacattcctcaacctt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616854 |
ctcctttcctgcaaagataatcacattgttggttggcaggtttatcaacgcataccccagagaacaaagcactcggtttttcacattcctcaacctt |
2616758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 152
Target Start/End: Complemental strand, 2643780 - 2643727
Alignment:
| Q |
99 |
gaaccactgagtaacttttctcctttcctgcaaagataatcacattgttggttg |
152 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2643780 |
gaaccactgagtaagccttctcctctcctgcaaagataaccacattgttggttg |
2643727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University