View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_70 (Length: 238)
Name: NF4513_high_70
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 36 - 229
Target Start/End: Original strand, 12812826 - 12813019
Alignment:
| Q |
36 |
tgataaagaaccatgatgttgatcaatgccatgatttgaagtgagcacatcatttatatgacaaggaagtaaatttataattgacacatgaattacgttc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12812826 |
tgataaagaaccatgatgttgatcaatgccataatttgaagtgagcacatcatttatatgacaaggaagtaaatttataattgacacatgaattacattc |
12812925 |
T |
|
| Q |
136 |
taaatgtcaagtcttatttcaactttatgatacgtggacatgaccatgcatgttccatatatgttgctatcttgggaccaatctatatgatgat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12812926 |
taaatgtcaagtcttatttcaactttatgatacatggacatgaccatgcatgttccatatatgttgctatctttggaccaatctatatgatgat |
12813019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 12812773 - 12812807
Alignment:
| Q |
1 |
tttttccttttgcaaaattattatggaagacaaaa |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12812773 |
tttttccttttgcaaaattattatggaagacaaaa |
12812807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University