View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_high_77 (Length: 215)
Name: NF4513_high_77
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_high_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 110 - 199
Target Start/End: Original strand, 8404726 - 8404815
Alignment:
| Q |
110 |
cttaattaccacacttgtcttggatgcttttggaacagaaaataaacaaagtcttggtggttttgggaaattgatacagcatgtgattct |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8404726 |
cttaattaccacacttgtcttagatgcttttggaacagaaaataaacaaagtcttggtagttttgggaaattgatacagcatgtgattct |
8404815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8404617 - 8404665
Alignment:
| Q |
1 |
tattaaattttgaagaattatatatactttcatcataatcaccatgatc |
49 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404617 |
tattaaaatttgaagaattatatatactttcatcataatcaccatgatc |
8404665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University