View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_100 (Length: 201)
Name: NF4513_low_100
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_100 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 53088848 - 53089018
Alignment:
| Q |
17 |
tcaatgtggttgatggtgaaccagtataaaatatgatatgtgatgcatgtgtcttattctctcctgctttatttacattctattttaatcaagttcttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53088848 |
tcaatgtggttgatggtgaaccagtataaaatatgatatatgatgcatgtgtcttattctctcctgctttatttacattctattttaatcaagttcttga |
53088947 |
T |
 |
| Q |
117 |
tggtttaactttactctattgaacaatgaacatatcatcgcggtcctccccaccatacgccatcaacttcc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53088948 |
tggtttaactttactctattgaacaatgaacatatcatcgtggtcctccccaccatacgccatcaacttcc |
53089018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University