View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_42 (Length: 322)
Name: NF4513_low_42
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 52 - 312
Target Start/End: Complemental strand, 26050156 - 26049895
Alignment:
| Q |
52 |
aaaaataatagaaatattcaagtcaatgtacaagctattgtgcagcattcaaatctaccatacatcaaaagatttgcatgagaaatatccaccaatttat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
26050156 |
aaaaataatagaaatattcaagtcaatgtacaagctattgtgcagcattcaaatctaccatacatcaaacgatttgcatgagaaatatccatcaatttat |
26050057 |
T |
 |
| Q |
152 |
cagcacgggtttgaattctccctggttgtcg-aatatagaatcagaacccaccaatgcagcaaaagtcatgtcaagtgttaaaaccagaagattcaaatc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26050056 |
cagcacgggtttgaattctccctggttgtcggaatataggatcagaacccaccaatgcagcaaaagtcatgtccagtgttaaaaccagaagattcaaatc |
26049957 |
T |
 |
| Q |
251 |
catatcaaattagcaacaccttatcaagaagtgcaattgccaactcgtcgtacctgcctttg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26049956 |
catatcaaattagcaacaccttatcaagaagtgcaattgccaactcgtcgtacctgcctttg |
26049895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University