View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_47 (Length: 296)
Name: NF4513_low_47
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 37588050 - 37588321
Alignment:
| Q |
19 |
tttccttctcttcggccaaatttggaatactagtattttttgactc-actcttttgctagaaacctaacttcattgtgttttttatcctttgagatttgc |
117 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588050 |
tttccttcttttcggccaaatctggaatactagtattttttgactctaatcttttgctagaaacctaacttcattgtgttttttatcctttgagatttgc |
37588149 |
T |
|
| Q |
118 |
ctttgatgatagaaacaacttctatattgcctttgatttactcttacccttcttttattttatgctgagttcaactttttacaggaggaaatacactgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
37588150 |
ctttgatgatagaaacaacttctatattgcctttgatttactcttacccttcttttattttatggtgagtttaactttttaccggaagaaatacactgtt |
37588249 |
T |
|
| Q |
218 |
attgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacatatagtttttcatctca |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37588250 |
attgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacatatagtttttcatctca |
37588321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 217 - 273
Target Start/End: Original strand, 33722010 - 33722065
Alignment:
| Q |
217 |
tattgatagtttctgccatttttcttctactgtcagatttctatctattgtgaacat |
273 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33722010 |
tattgatagtttctgctatttttctttta-tgtcagatttctatctattgtgaacat |
33722065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University