View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_63 (Length: 252)
Name: NF4513_low_63
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 105 - 242
Target Start/End: Complemental strand, 41919952 - 41919815
Alignment:
| Q |
105 |
gaaccttatgattcggttccttttttaaaacatctttaattatgaatattttaaaaatccaagattgaattattgagtttgaaataattatgaaagtgga |
204 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41919952 |
gaaccatatgattcggttcgttttttaaaacatctttaattatgaatattttaaaaatccaagattgaattattgagtttgaaataattatgaaagtgga |
41919853 |
T |
 |
| Q |
205 |
ccttcaagtttgacaagtataagaacttccatcctttg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41919852 |
ccttcaagtttgacaagtataagaacttccaccctttg |
41919815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 41920093 - 41919982
Alignment:
| Q |
1 |
ttttcttttcaaatcaatactttaacaacaaaacctgaatcatggttcaactgttttaaaccgcttaaacatgataaagattcaattgaaacatttaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41920093 |
ttttcttttcaaatcaatactttaacaacaaaacctgaatcatggttcaactgttttaaaccgcttaaacatgataaagattcaattgaaccatttaaat |
41919994 |
T |
 |
| Q |
101 |
aaccgaacctta |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41919993 |
aaccgaacctta |
41919982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University