View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_71 (Length: 248)
Name: NF4513_low_71
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 62 - 243
Target Start/End: Original strand, 52623775 - 52623950
Alignment:
| Q |
62 |
tcggtctattaaagttctacaaccttatacataacattttttaatgtttgctaaaatcacaatatgacagattatgttacatgctaatacatattggtat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52623775 |
tcggtctattaaagttctacaaccttatacataatattttttaatgtt-gctaaaatcacaatatgacagattatgttacatgccaatacatattggtat |
52623873 |
T |
 |
| Q |
162 |
gaatgaaatgaatgaatggataccggattaagagtgttatggagcttgaaggtggtctcaagcatggatgattgctcctttg |
243 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52623874 |
gaatg-----aatgaatggataccggattaagagtgttatggagcttgaaggtgctctcaagcatggatgattgctcctttg |
52623950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University