View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_86 (Length: 238)
Name: NF4513_low_86
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_86 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 24265447 - 24265576
Alignment:
| Q |
1 |
taaattttgtatacatcgtcattcaataaaattccaccacataaaaagtgtttaatttaatcatttatgccttcaaacagttcatatcaaaaaagtgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
24265447 |
taaattttgtatacatcgtcattcaataaaattccaccacataaaa-gtgtttaatttaatcatttataccttcaaacagttcatatcaaaatagtgttt |
24265545 |
T |
|
| Q |
101 |
ggtgtccgacacaacaccaagatatgtgatt |
131 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
24265546 |
ggtgtcagacacaacaccaagatatgtgatt |
24265576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 130
Target Start/End: Complemental strand, 5960789 - 5960740
Alignment:
| Q |
81 |
ttcatatcaaaaaagtgtttggtgtccgacacaacaccaagatatgtgat |
130 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5960789 |
ttcatatcaaaagcatgtttggtgtccgacacaacaccaacatatgtgat |
5960740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University