View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4513_low_89 (Length: 235)
Name: NF4513_low_89
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4513_low_89 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 235
Target Start/End: Original strand, 52623419 - 52623632
Alignment:
| Q |
22 |
ataaataaaattaaataggtgatatattcagttatgaaacccagataatatgaagaaaaattaatggtagacaaaagtaacaacatagttataagatcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52623419 |
ataaataaaattaaataggtgatatattcagttacgaaacccagataatatgaagaaaaattaatgttagacaaaagtaacaacatagttataagatcaa |
52623518 |
T |
|
| Q |
122 |
tgaaatggacccataaattaattaattaacgtaccttgctctcctgttctgaaaccaaacttctatttgtcttgcctttaaactcaattggtcagcaagt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52623519 |
tgaaatggacccataaattaattaattaacgtaccttgctctcctgttctgaaaccaaacttcaatttgtcttgtctttaaactcaattggtcagcaagt |
52623618 |
T |
|
| Q |
222 |
gctattttctgaac |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52623619 |
gctattttctgaac |
52623632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 16810322 - 16810252
Alignment:
| Q |
153 |
taccttgctctcctgttctgaaaccaaacttctatttgtcttgcctttaaactcaattggtcagcaagtgc |
223 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | |||||| ||||||| |||||| ||||||||||| |
|
|
| T |
16810322 |
taccttgctcttctgttctggaaccaaacttcaacctgtctttgctttaaattcaattcctcagcaagtgc |
16810252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 16849603 - 16849533
Alignment:
| Q |
153 |
taccttgctctcctgttctgaaaccaaacttctatttgtcttgcctttaaactcaattggtcagcaagtgc |
223 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | |||||| ||||||| |||||| ||||||||||| |
|
|
| T |
16849603 |
taccttgctcttctgttctggaaccaaacttcaacctgtctttgctttaaattcaattcctcagcaagtgc |
16849533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University