View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4513_low_96 (Length: 215)

Name: NF4513_low_96
Description: NF4513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4513_low_96
NF4513_low_96
[»] chr2 (2 HSPs)
chr2 (110-199)||(8404726-8404815)
chr2 (1-49)||(8404617-8404665)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 110 - 199
Target Start/End: Original strand, 8404726 - 8404815
Alignment:
110 cttaattaccacacttgtcttggatgcttttggaacagaaaataaacaaagtcttggtggttttgggaaattgatacagcatgtgattct 199  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
8404726 cttaattaccacacttgtcttagatgcttttggaacagaaaataaacaaagtcttggtagttttgggaaattgatacagcatgtgattct 8404815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8404617 - 8404665
Alignment:
1 tattaaattttgaagaattatatatactttcatcataatcaccatgatc 49  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
8404617 tattaaaatttgaagaattatatatactttcatcataatcaccatgatc 8404665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University