View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4514_high_5 (Length: 337)

Name: NF4514_high_5
Description: NF4514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4514_high_5
NF4514_high_5
[»] chr4 (1 HSPs)
chr4 (14-319)||(23128659-23128964)


Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 14 - 319
Target Start/End: Original strand, 23128659 - 23128964
Alignment:
14 gagatgaacaagtatcagccacgcgattttttctgatatctccgacgaagatgatgatgacgaggatgacgatgaattctcgctgcgcataggacttcga 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||    
23128659 gagaagaacaagtatcagccacgcgattttttctgatatctccgatgaagatgatgatgacgaggatgacgatgaattctcgctgcgcatcggacttcga 23128758  T
114 tagtacgactccggtaacggagactgcggcatatcgaagacgatatcagcgagaattccaccgtaatcggcgaggaaggttaggtaattcatgacatagc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23128759 tagtacgactccggtaacggagactgcggcatatcgaagacgatatcagcgagaattccaccgtaatcggcgaggaaggttaggtaattcatgacatagc 23128858  T
214 gtgtgagaggatgaacaccaccaccggagacttgtttctttgaagaatctttctgaatagctgattcgaattcctttaacatcgttttaacagcttctgc 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23128859 gtgtgagaggatgaacaccaccaccggagacttgtttctttgaagaatctttctgaatagctgattcgaattcctttaacatcgttttaacagcttctgc 23128958  T
314 gagttt 319  Q
     |||||    
23128959 aagttt 23128964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University