View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4514_high_7 (Length: 321)
Name: NF4514_high_7
Description: NF4514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4514_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 306
Target Start/End: Complemental strand, 41544285 - 41544001
Alignment:
| Q |
17 |
tccacacctattcaaacctgcaaacaaaattgcagcacttactttggtttcaagtaacaacttttctcccctttcttttctaaacttgtaaatttttcac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41544285 |
tccacacctattcaaacctgcaaacaaaattgcagcacttactttggtttcaagtaacaacttttttcccctttcttttctaaacttgtaaatttttcac |
41544186 |
T |
 |
| Q |
117 |
ttgtgacttgtgagtagtaataaattaaaagaataacttttgtcttatcacctgaattgtttgcaacagttttccatttcttggcaccatgaatttggat |
216 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41544185 |
ttgtgacttttgagtagtaataaa-----agaataacttttgtcttatcacctgaattgtttgcaacagttttccatttcttggcaccatgaatttggat |
41544091 |
T |
 |
| Q |
217 |
gcattgtgctagcttttgatcttcctcttgggtccatgctcctctattcattgtttcctttgtaggtccatcttttctgggtgccataac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41544090 |
gcattgtgctagcttttgatcttcctcttgggtccatgctcctctattcattgtttcctttgtaggtccatcttttctgggtgccataac |
41544001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University