View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4514_low_13 (Length: 278)
Name: NF4514_low_13
Description: NF4514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4514_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 17 - 150
Target Start/End: Complemental strand, 35202726 - 35202593
Alignment:
| Q |
17 |
cagaagaagaacttgaaactcttgtagaattgaaccttgttgcaaaaggaaagttcatcacatcatgacaagaagagttaccataaagaagagaattgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202726 |
cagaagaagaacttgaaactcttgtagaattgaaccttgttgcaaaaggaaagttcatcacatcatgacaagaagagttaccataaagaagagaattgat |
35202627 |
T |
 |
| Q |
117 |
atggtttgaggtagaagcaatatcaaaactatgg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35202626 |
atggtttgaggtagaagcaatatcaaaactatgg |
35202593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 35202572 - 35202489
Alignment:
| Q |
177 |
agaaggagggtttgaattagcactagtaggagttgaagaagaaggagaagcagtagcagtatcaatatttgaagaggagtgatt |
260 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35202572 |
agaaggagggtttgaattagcactattaggagttgaagaagaaggagaagcagtagcagtatcaatatttgaagaagagtgatt |
35202489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University