View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515-Insertion-4 (Length: 377)
Name: NF4515-Insertion-4
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 6 - 377
Target Start/End: Original strand, 5982596 - 5982967
Alignment:
| Q |
6 |
caatgtcagggtaccgaccattctcaccaccaatgtcagggtatcaaccattctcaggatatcgtccaccaccaatgccttggtaccaacctcaacatgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982596 |
caatgtcagggtaccgaccattctcaccaccaatgtcagggtatcaaccattctcaggatatcgtccaccaccaatgccttggtaccaacctcaacatgc |
5982695 |
T |
|
| Q |
106 |
tggatatgcaataccaccaccaatgtatccaggatcagggcctctacatggttacaatggatatagtcatcccatgggaccacatggttacaatggatat |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982696 |
tggatatgcaataccaccacaaatgtatccaggatcagggcctctacatggttacaatggatatagtcatcccatgggaccacatggttacaatggatat |
5982795 |
T |
|
| Q |
206 |
ggtcatctcatgggaccggattatggacattatggttcaaggatgccaatgtcaagacccaatcccatgatccactacaacagttatgctgacaattatc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982796 |
ggtcatctcatgggaccggattatggacattatggttcaaggatgccaatgtcaagacccaatcccatgatccactacaacagttatgctgacaattatc |
5982895 |
T |
|
| Q |
306 |
gctatactatgtagatgaagtatgtcaaagttgttggctacaagaacttactatggtttacttttcagacta |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982896 |
gctatactatgtagatgaagtatgtcaaagttgttggctacaagaacttactatggtttacttttcagacta |
5982967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University