View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515-Insertion-5 (Length: 203)
Name: NF4515-Insertion-5
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 203
Target Start/End: Original strand, 27744968 - 27745163
Alignment:
| Q |
8 |
acaatgtctttatcagaatctaagtacgaccccccgccggctccagcacataagaccccaccggcactagtagccttcaccctcaccgtcctcatcctat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27744968 |
acaatgtctttatcagaatctaagtacgaccccccaccggctccagcacataagaccccaccggcactagtagccttcaccctcaccgtcctcatcctat |
27745067 |
T |
|
| Q |
108 |
gctttgtggctttcagcattgtgtatctttgcaagtattgctttgcaggcattttccatatgtgggccttgcatcgcacggcctcaggatccctcg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27745068 |
gctttgtggctttcagcattgtgtatctttgcaagtattgctttgcaggcattttccatatgtgggccttgcatcgcacggcctcaggatccctcg |
27745163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 32844649 - 32844843
Alignment:
| Q |
9 |
caatgtctttatcagaatctaagtacgaccccccgccggctccagcacataagaccccaccggcactagtagccttcaccctcaccgtcctcatcctatg |
108 |
Q |
| |
|
||||||||| ||| || ||||||||||| |||| ||||| ||| || | |||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
32844649 |
caatgtcttcatcggagcctaagtacgacaccccaccggccccaacatacaagaccccaccggctctagtagccttcaccctcaccgtcctcatcttatg |
32844748 |
T |
|
| Q |
109 |
ctttgtggctttcagcattgtgtatctttgcaagtattgctttgcaggcattttccatatgtgggccttgcatcgcacggcctcaggatccctcg |
203 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||| ||||| ||| ||||||| | ||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
32844749 |
ctttgtggctttcagcgttgtgtatgtttgcaagtattgttttgctggctttttccacacttgggccttgcaacgcacgacctcaggttccctcg |
32844843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University