View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515-Insertion-6 (Length: 166)
Name: NF4515-Insertion-6
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 9e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 9e-84
Query Start/End: Original strand, 10 - 166
Target Start/End: Complemental strand, 11697487 - 11697331
Alignment:
| Q |
10 |
ttcaactgccattccatttggtgaatcatctcatagattatgttccattgaggtatagacttgtcttgtgaaacaaacttgtacactttcctctttgctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697487 |
ttcaactgccattccatttggtgaatcatctcatagattatgttccattgaggtatagacttgtcttgtgaaacaaacttgtacactttcctctttgctt |
11697388 |
T |
|
| Q |
110 |
caattaaactaaacccgggtgtttgtaccaagtttctttcggctaattttgttctga |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697387 |
caattaaactaaacccgggtgtttgtaccaagtttctttcggctaattttgttctga |
11697331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University