View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515_high_12 (Length: 286)
Name: NF4515_high_12
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 173 - 269
Target Start/End: Complemental strand, 13141539 - 13141443
Alignment:
| Q |
173 |
tagaagatgaatcctgataagaaaagccatccataaactaaccccaatctagttccattgctgcaccaggtaatgttgaaagctgaagtggtgtagt |
269 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141539 |
tagaagatgaatcctgataagaaaagctgtccataaactaaccccaatctagttccatttctgcaccaggtaatgttgaaagctgaagtggtgtagt |
13141443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 11 - 139
Target Start/End: Complemental strand, 13142223 - 13142095
Alignment:
| Q |
11 |
cagagagtagatgaataaaatacaagcatagcaccgttcgaggtaaacaaaactaatgcacaacactctttattgatgcggaaatgtatgtccttctaat |
110 |
Q |
| |
|
|||||||||| ||| |||||||||| |||| |||||||| | ||||||||||||||||| ||||| |||||||| || |||||||||| ||||||||| |
|
|
| T |
13142223 |
cagagagtaggtgagtaaaatacaaacatatcaccgttctcgttaaacaaaactaatgcatgacactttttattgaagcagaaatgtatgcccttctaat |
13142124 |
T |
 |
| Q |
111 |
gatccagagaaacaaaatgtatcaatgta |
139 |
Q |
| |
|
||| | |||||||| ||||||| |||||| |
|
|
| T |
13142123 |
gatacggagaaacagaatgtataaatgta |
13142095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University