View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515_high_17 (Length: 257)
Name: NF4515_high_17
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 24962660 - 24962439
Alignment:
| Q |
19 |
aacaatgtctatgttccgagggacgaatccttctcagaattaaagcaactctcgttttcagcaaataccttacaatcggctttccatgcgcttttaccgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24962660 |
aacaatgtctatgttccgagggacgaatccttctcagaattaaagcaactctcgttttcagcaaataccttacaatcggctttccatgcgcttttaccgg |
24962561 |
T |
|
| Q |
119 |
tcgtgaaaacagctgtaattgacaagaatcttggattccctcttttctcagccatagatgaccttttcaatgaaggatttaacttgcctcctcaagctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24962560 |
tcgtgaaaacagctgtaattgacaagaatcttggattccctcttttctcagccatagatgaccttttcaatgaaggatttaacttgcctcctcaagctga |
24962461 |
T |
|
| Q |
219 |
aaaagggtttcttgcgtctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24962460 |
aaaagggtttcttgcgtctgtg |
24962439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University