View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4515_high_20 (Length: 244)

Name: NF4515_high_20
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4515_high_20
NF4515_high_20
[»] chr4 (1 HSPs)
chr4 (15-109)||(2155093-2155189)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 2155093 - 2155189
Alignment:
15 ctagacatgtcctcacactatgtcatttata--tgccccgtttgttattcattcagcactaaaagtagataaacaaatatgggtatgtttaatcagg 109  Q
    |||||||||||| ||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2155093 ctagacatgtccacacactatgtcatttatatatgccccgtttattattcattcagcactaaaagtagataaacaaatatgggtatgtttaatcagg 2155189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University