View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515_low_22 (Length: 244)
Name: NF4515_low_22
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 2155093 - 2155189
Alignment:
| Q |
15 |
ctagacatgtcctcacactatgtcatttata--tgccccgtttgttattcattcagcactaaaagtagataaacaaatatgggtatgtttaatcagg |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2155093 |
ctagacatgtccacacactatgtcatttatatatgccccgtttattattcattcagcactaaaagtagataaacaaatatgggtatgtttaatcagg |
2155189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University