View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515_low_28 (Length: 214)
Name: NF4515_low_28
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 4 - 194
Target Start/End: Complemental strand, 37163621 - 37163431
Alignment:
| Q |
4 |
ggcaaaaatggcactagacacatgcaagcaattaatggatctttctattggcgaatttgataggtcaatagagggaatnnnnnnntttgatctcaataat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37163621 |
ggcaaaaatggcactagacacatgcaagcaattaatggatctttctattggcgaattcgataggtcaatagagggaataaaaaattttgatctcaataat |
37163522 |
T |
|
| Q |
104 |
ttagaaaacattcttgtgaatttaaaggtttggttaagtggtgcaattacataccaagaaacttgtttagatggttttgagaatactacta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37163521 |
ttagaaaacattcttgtgaatttaaaggtttggttaagtggtgcaattacataccaagaaacttgtttagatggttttgagaatactacta |
37163431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 134 - 192
Target Start/End: Original strand, 46314705 - 46314763
Alignment:
| Q |
134 |
tggttaagtggtgcaattacataccaagaaacttgtttagatggttttgagaatactac |
192 |
Q |
| |
|
|||||||| ||||| || |||||||||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
46314705 |
tggttaagcggtgccatcacataccaagaaacatgtttggatgcttttgagaatactac |
46314763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University