View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4515_low_6 (Length: 383)
Name: NF4515_low_6
Description: NF4515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4515_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 375
Target Start/End: Complemental strand, 25445923 - 25445553
Alignment:
| Q |
18 |
ctcttttcttccgtagtatgcatatgtaaatgtaagcatcgtagagaggagcggagatcaattctgagtaagagatacat-------------ctgattg |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
25445923 |
ctcttttcttctgtagtatgcatatgtaa------gcatcgtagagaggagcggagatcatttctgagtaagagatacattttggtattcatactgattg |
25445830 |
T |
|
| Q |
105 |
atagcagaa------agaaagaagaaagagcgattgaattttgagaaagatggatttggaatcagttggagatttagcgattcatgaaattctggataat |
198 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
25445829 |
atagcagaagcagaaagaaagaagaaagagcgattgaattttgagaaagatggatttggaatcagttggagatttagcgattcatgaaattatggaaaat |
25445730 |
T |
|
| Q |
199 |
cttaaacccgaagacattgccagaatttcatgtgtcagtaacaggttcaaatctttcacctccgatgactctctttggtccaaaatctgcttccttgaac |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25445729 |
cttaaacccgaagacattgccagaatttcatgtgtcagtaacaggttcaaatctttcacctccgatgactctctttggtccaaaatctgcttccgtgaac |
25445630 |
T |
|
| Q |
299 |
tctctctcactcaacccattgatcatctcggaaacccgaccccttccttcaaggtcactcttccctcctttttatca |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25445629 |
tctctctcactcaacccattgatcatctcggaaacccgaccccttccttcaaggtcactcttccctcctttttatca |
25445553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University