View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4516-Insertion-5 (Length: 209)
Name: NF4516-Insertion-5
Description: NF4516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4516-Insertion-5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 6 - 209
Target Start/End: Original strand, 2332282 - 2332485
Alignment:
| Q |
6 |
catctattccaatcaaatgatccctgtaaacctctcatatagtttacaactggataatattccatctcttagcattaacttgatggaccagcttctcttg |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2332282 |
catctatcccaatcaaatgatccctgtaaacctctcatatagtttacaactggataatattccatctcttggcattagcttgatggaccagcttctcttg |
2332381 |
T |
|
| Q |
106 |
cctgtaactatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgtt |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332382 |
cctgtcactatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgtt |
2332481 |
T |
|
| Q |
206 |
ggca |
209 |
Q |
| |
|
|||| |
|
|
| T |
2332482 |
ggca |
2332485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University