View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4516_high_18 (Length: 237)
Name: NF4516_high_18
Description: NF4516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4516_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 15 - 125
Target Start/End: Complemental strand, 7441639 - 7441529
Alignment:
| Q |
15 |
aattaaatcatgtcgcttttaattttttacatttgtatgtttgcccatatagattgaatttgaagctgtgttcaagtaagaattgatcacacaaaaatat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7441639 |
aattaaatcatgtcgcttttaattttttacatttgtatgtttgcccatatagattggatttgaagctgtgttcaagtaagaattgaacacacaaaaatat |
7441540 |
T |
|
| Q |
115 |
tgttaacttgt |
125 |
Q |
| |
|
||||||||||| |
|
|
| T |
7441539 |
tgttaacttgt |
7441529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 135 - 202
Target Start/End: Complemental strand, 7441503 - 7441436
Alignment:
| Q |
135 |
tgcaaaaagtgtaaattaccttacatctttattgttagacctatttcatggcaatcttatttaggtat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7441503 |
tgcaaaaagtgtaaattaccttacatctttattgttagacctatttcatggcaatcttatttaggtat |
7441436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University