View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4516_low_1 (Length: 508)
Name: NF4516_low_1
Description: NF4516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4516_low_1 |
 | |
|
| [»] scaffold0007 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 163; Significance: 8e-87; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 163; E-Value: 8e-87
Query Start/End: Original strand, 241 - 403
Target Start/End: Complemental strand, 149871 - 149709
Alignment:
| Q |
241 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
|
| Q |
341 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttg |
149709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 150111 - 149988
Alignment:
| Q |
1 |
tcccttttcttagttgttgatgaacttgttggtctaactcttgtaacctatttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150111 |
tcccttttcttagttgttgatgaacttgttgttctaactcttgtaacctatttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagt |
150012 |
T |
|
| Q |
101 |
tgtctctgatgaagaagcagctaa |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
150011 |
tgtctctgatgaagaagcagctaa |
149988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 441 - 501
Target Start/End: Complemental strand, 149671 - 149611
Alignment:
| Q |
441 |
attggtcttgttgtttctgttatggattcttcatgttgtggttttggtgatgatgatgatg |
501 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149671 |
attggccttgttgtttctattatggattcttcatgttgtggttttggtgatgatgatgatg |
149611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University