View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4516_low_10 (Length: 315)
Name: NF4516_low_10
Description: NF4516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4516_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 84 - 298
Target Start/End: Complemental strand, 56099467 - 56099247
Alignment:
| Q |
84 |
ttattaatttgagtactactacatagttaggatagggattctaactagcttctcctttgatgttcatgatgaatcatcaaacaaaa------caactact |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
56099467 |
ttattaatttgagtactactacatagttaggatagggattctaactagcttctcctttgatgttcatgatgaatcatcaaacaaaaacaaaacaactact |
56099368 |
T |
 |
| Q |
178 |
cgatcatagttaagcataaaataataagtcttggtgatgtctgtccagtactcatttatattgatggtgatgatgatgaccattggcttcagcatttgca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56099367 |
cgatcatagttaagcataaaataataagtcttggtgatgtctgtccagtactcatttatattgatggtgatgatgatgaccattggcttcagcatttgca |
56099268 |
T |
 |
| Q |
278 |
agtgcctgagaatgagatgag |
298 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
56099267 |
agtgcctgagaatgagatgag |
56099247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University