View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4516_low_17 (Length: 240)
Name: NF4516_low_17
Description: NF4516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4516_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 32417651 - 32417864
Alignment:
| Q |
19 |
ccttactcgaatttcgccgcgaaacaggagaatcattcggagtagtgattgtttttgctttctcagtttcaagatcattcatcatgttgattatgctcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32417651 |
ccttactcgaatttcgccgcgaaacaggagaatcattcggagtagtgattgtttttgctttctcagtttcaagaccattcatcatgttgattatgctcct |
32417750 |
T |
|
| Q |
119 |
aactccttcataacatgccccacatatcgtattccttggaggccttaatattaatggcatagttgtgcacacacaacaatccatttttgcttcttagaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32417751 |
aactccttcataacatgccccacatattgtattccttggaggccttaatattaatggcatagttgtgcacacacaacaatccatttttgcttcttagaat |
32417850 |
T |
|
| Q |
219 |
ttctctcctatgct |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32417851 |
ttctctcctatgct |
32417864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University