View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4516_low_23 (Length: 215)
Name: NF4516_low_23
Description: NF4516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4516_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 46925252 - 46925065
Alignment:
| Q |
16 |
aaaggagttaatgatcatagagc---acttacatatttatccattgggtaaaaagctgagaacttatgagaatgtatgtaacagcctggcttaatgacac |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46925252 |
aaaggagttaatgatcatagagctatacttacatatttatccattgggtaaaaagctgagaacttatgagaatgtatgtaacagcctggcttaatgacac |
46925153 |
T |
|
| Q |
113 |
atttctaaggctttcttgcattatttttgtaccaaacgaaaaacacaaaataatttgcatcttagtaattttcataacccgatgaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46925152 |
atttctaaggctttcttgcattatttttgtaacaaacgaaaaacacaaaataatttgcatcttagtaattttcataacccgatgaaag |
46925065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University