View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4517-Insertion-5 (Length: 96)
Name: NF4517-Insertion-5
Description: NF4517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4517-Insertion-5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 35605658 - 35605570
Alignment:
| Q |
8 |
gttgaattggttgggaacaagcttcaagagcttcgtagccgtcgacaagaggggtctcttagagatattatgttctgtatgcgtgctga |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35605658 |
gttgaattggttgggaacaagcttcaagagcttcgtagccgtcgacaagaggggtctcttagagatattatgttttgtatgcgtgctga |
35605570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 51 - 88
Target Start/End: Original strand, 39129295 - 39129332
Alignment:
| Q |
51 |
gacaagaggggtctcttagagatattatgttctgtatg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| |
|
|
| T |
39129295 |
gacaagaggggtctcttagagatattatcttttgtatg |
39129332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University